How can I force a long string without any blank to be wrapped?

I have a long string (a DNA sequence). It does not contain any whitespace character.

For example:

ACTGATCGAGCTGAAGCGCAGTGCGATGCTTCGATGATGCTGACGATGCTACGATGCGAGCATCTACGATCAGTCGATGTAGCTAGTAGCATGTAGTGA

What would be the CSS selector to force this text to be wrapped in a html:textarea or in a xul:textbox?

for block elements:

<textarea style="width:100px; word-wrap:break-word;">
  ACTGATCGAGCTGAAGCGCAGTGCGATGCTTCGATGATGCTGACGATGCTACGATGCGAGCATCTACGATCAGTC
</textarea>

for inline elements:

<span style="width:100px; word-wrap:break-word; display:inline-block;"> 
   ACTGATCGAGCTGAAGCGCAGTGCGATGCTTCGATGATGCTGACGATGCTACGATGCGAGCATCTACGATCAGTC
</span>

Place zero-width spaces at the points where you want to allow breaks. The zero-width space is ​ in HTML. For example:

ACTGATCG​AGCTGAAG​CGCAGTGC​GATGCTTC​GATGATGC

Here are some very useful answers:

How to prevent long words from breaking my div?

to save you time, this can be solved with css:

white-space: -moz-pre-wrap; /* Mozilla */
white-space: -hp-pre-wrap; /* HP printers */
white-space: -o-pre-wrap; /* Opera 7 */
white-space: -pre-wrap; /* Opera 4-6 */
white-space: pre-wrap; /* CSS 2.1 */
white-space: pre-line; /* CSS 3 (and 2.1 as well, actually) */
word-wrap: break-word; /* IE */
word-break: break-all;

For me this works,

<td width="170px" style="word-wrap:break-word;">
  <div style="width:140px;overflow:auto">
    LONGTEXTGOESHERELONGDIVGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESHERELONGDIVLONGTEXTLONGTEXT
  </div>
</td>

You can also use a div inside another div instead of td. I used overflow:auto, as it shows all the text both in my Opera and IE browsers.

I don't think you can do this with CSS. Instead, at regular 'word lengths' along the string, insert an HTML soft-hyphen:

ACTGATCG­AGCTGAAG­CGCAGTGC­GATGCTTC­GATGATGC­TGACGATG

This will display a hyphen at the end of the line, where it wraps, which may or may not be what you want.

Note Safari seems to wrap the long string in a <textarea> anyway, unlike Firefox.